Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU042191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wee1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAAGACATGGAAGCCAGTGATTATGAGTTTGAAGATGAAACAAGACCTGCCAAAAGAATTACAATTACTGAAAGCAACATGAAGTCACGGTATACAACTGAATTTCATGAGCTGGAGAAAATTGGTTCTGGAGAATTTGGTTCTGTGTTTAAATGTGTGAAGAGGTTAGATGGATGCATTTATGCCATTAAACGATCAAAAAAACCATTGGCTGGCTCTGTTGATGAGCAGAATGCTTTGAGAGAAGTGTATGCTCACGCTGTGCTTGGACAGCACCCCCACGTCGTTCGCTATTTCTCTGCCTGGGCAGAGGATGACCACATGCTTATACAGAACGAATACTGTAATGGTGGGAGTTTAGCTGATGCTATAAGTGAGAACTACAGAGTCATGAGCTACTTGACTGAAGTAGAGCTGAAGGATCTCCTTTTGCAAGTTGGCCGGGGCTTGAGATACATACATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTTATATCTCGAACCTCAATCCCAAATGCTG

Numéro d'accès Ensembl | souris

ENSMUSG00000031016

Numéro d'accès NCBI

NM_009516

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... WEE1(22390) , Wee1(22390)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique