Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU033001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gja3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTTCGAAGTGGGGTTCATCGCGGGCCAGTACTTTCTATACGGCTTCCAGCTGCAGCCACTTTACCGCTGCGACCGCTGGCCCTGCCCCAACACTGTGGACTGTTTCATCTCCAGGCCCACAGAGAAGACCATCTTTGTCATCTTCATGCTGGCTGTGGCCTGTGCGTCACTGGTACTCAACATGCTGGAGATTTACCACCTGGGCTGGAAGAAGCTCAAGCAGGGAGTTACTAACCACTTCAACCCAGATGCCTCAGAAGCCAGGCACAAGCCCTTGGACCCCCTACCCACGGCCACCAGCTCTGGCCCGCCCAGCGTCTCCATCGGGTTCCCACCTTATTACACACACCCTGCCTGTCCCACAGTACAGGCAAAGGCCATAGGGTTTCCTGGGGCCCCACTATCACCAGCAGACTTCACAGTGGTGACTCTAAACGATGCTCAAGGCAGAAACCACCCAGTCAAACACTGCAATGG

Numéro d'accès Ensembl | souris

ENSMUSG00000048582

Numéro d'accès NCBI

NM_016975

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GJA3(14611) , Gja3(14611)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and
Lingzhi Wang et al.
Oncology reports, 34(4), 2133-2141 (2015-08-12)
Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of
S Morel et al.
Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)
Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique