Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU032471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chek2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACAAGCGCCTGAAAGAAGCCACCTGTAAGCTCTACTTCTACCAGATGCTTGTAGCTGTACAGTACCTTCACGAAAATGGGATCATACATCGGGACTTAAAGCCGGAGAATGTTCTTTTATCATCTCAGGAAGAGGATTGTCTAATCAAGATCACTGACTTTGGGCAGTCCAAGATCTTGGGGGAGACCTCCTTGATGAGAACCTTATGTGGTACGCCCACTTATCTGGCTCCTGAGGTTCTTGTCTCCAACGGGACTGCTGGGTACAGCCGCGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTCATCTGCCTAAGTGGGTATCCACCTTTCTCTGAGCATAAGACCCAAGTGTCCCTGAAGGATCAGATCACCAGTGGAAAGTACAACTTTATTCCTGAAGTCTGGACAGATGTCTCAGAGGAGGCTCTGGACCTTGTCAAGAAACTGTTAGTTGTAGACCCAAAGGCTCG

Numéro d'accès Ensembl | souris

ENSMUSG00000029521

Numéro d'accès NCBI

NM_016681

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CHEK2(50883) , Chek2(50883)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
Chao-Ying Huang et al.
PloS one, 9(8), e104732-e104732 (2014-08-12)
In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique