Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU028701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dram1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGATTGCCTGTGCTTCACTCATTTCTATAACCAAGCTGGAATGGAATCCAAAAGAAAAGGATTATATATATCACGTGGTGAGCGCCATCTGTGAGTGGACCGTGGCTTTTGGTTTTATTTTCTATTTCCTAACATTCATCCAAGATTTCCAGAGTGTCACTCTAAGGATATCCACAGAAATCAATGACGACTTTTGAAAGATCGAGAATCCTGTCTCATTCAGGGAGTGTCGCAGACAGTTTCTGGAAGTGGACAGAGGACGGACGGGCTTGGATGTCACCCTGATGGGGACTTTATCTGTGGCACATCCGGGACTTGAATTTCATTAAGAGTTCCTAGTAGTTCAATTTACAAAGGTATGTTTCCCTGGAGGATGGATAGCACCAACGACACTGTAGCAATATTTTTATATTTTCTAAAACAATCTTTTATGAACAAATTCATATGCAAAGAAGACGAGGCAT

Numéro d'accès Ensembl | souris

ENSMUSG00000020057

Numéro d'accès NCBI

NM_027878

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... DRAM1(71712) , 1200002N14Rik(71712)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

K Liu et al.
Cell death & disease, 5, e1323-e1323 (2014-07-18)
Apoptosis-stimulating protein of p53-2 (ASPP2) induces apoptosis by promoting the expression of pro-apoptotic genes via binding to p53 or p73; however, the exact mechanisms by which ASPP2 induces apoptotic death in hepatoma cells are still unclear. Here, we show that
Brandon J Metge et al.
Scientific reports, 5, 11995-11995 (2015-07-07)
We have previously reported that expression of NMI (N-myc and STAT interactor) is compromised in invasive breast cancers. We also demonstrated that loss of NMI expression promotes epithelial-mesenchymal-transition and results in enhanced invasive ability of breast cancer cells. Additionally we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique