Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU016691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fis1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGGGGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAATTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTCGAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAAAGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCTCTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGATTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jichi Zhou et al.
Cell stress & chaperones, 24(2), 369-383 (2019-01-19)
Sirtuin 3 (Sirt3)-modified mitochondrial fission participates in the progression of several types of cancers. However, its role in tongue cancer requires investigation. The aim of our study is to determine whether Sirt3 knockdown regulates the viability of tongue cancer cells
Qinfang Shen et al.
Molecular biology of the cell, 25(1), 145-159 (2013-11-08)
Mitochondrial fission is mediated by the dynamin-related protein Drp1 in metazoans. Drp1 is recruited from the cytosol to mitochondria by the mitochondrial outer membrane protein Mff. A second mitochondrial outer membrane protein, named Fis1, was previously proposed as recruitment factor
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Mitsuo Kato et al.
Communications biology, 4(1), 30-30 (2021-01-06)
Diabetic kidney disease (DKD) is a major complication of diabetes. Expression of members of the microRNA (miRNA) miR-379 cluster is increased in DKD. miR-379, the most upstream 5'-miRNA in the cluster, functions in endoplasmic reticulum (ER) stress by targeting EDEM3.
Hidenori Otera et al.
The Journal of cell biology, 191(6), 1141-1158 (2010-12-15)
The cytoplasmic dynamin-related guanosine triphosphatase Drp1 is recruited to mitochondria and mediates mitochondrial fission. Although the mitochondrial outer membrane (MOM) protein Fis1 is thought to be a Drp1 receptor, this has not been confirmed. To analyze the mechanism of Drp1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique