Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU012051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnf

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGAAGGGAATGGGTGTTCATCCATTCTCTACCCAGCCCCCACTCTGACCCCTTTACTCTGACCCCTTTATTGTCTACTCCTCAGAGCCCCCAGTCTGTGTCCTTCTAACTTAGAAAGGGGATTATGGCTCAGAGTCCAACTCTGTGCTCAGAGCTTTCAACAACTACTCAGAAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAAATGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAGTGGTCAGGTTGCCTCTGTCTCAGAATGAGGCTGGATAAGATCTCAGGCCTTCCTACCTTCAGACCTTTCCAGACTCTTCCCTGAGGTGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Valentina Pileczki et al.
International journal of molecular sciences, 14(1), 411-420 (2012-12-25)
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine involved in the promotion and progression of cancer, including triple negative breast cancer cells. Thus, there is significant interest in understanding the molecular signaling pathways that connect TNF-α with the survival
Hank Cheng et al.
Journal of neuroinflammation, 13, 19-19 (2016-01-27)
The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in
Li Peng et al.
The International journal of artificial organs, 38(10), 565-571 (2015-11-07)
Periprosthetic osteolysis, involving RANK/RANKL/osteoprotegerin (OPG) and TNF-α/NFκB signaling, contributes to bone resorption and inflammation. We constructed lentivirus vectors to inhibit TNF-α and enhance OPG expression and assessed their impacts on wear debris-induced inflammation and osteoclastogenesis in an osteoclast/osteoblast coculture system.
Wenwen Zheng et al.
Molecular pain, 7, 40-40 (2011-05-24)
HIV-associated sensory neuropathy (HIV-SN) is one of the most common forms of peripheral neuropathy, affecting about 30% of people with acquired immune deficiency syndrome (AIDS). The symptoms of HIV-SN are dominated by neuropathic pain. Glia activation in the spinal cord
Praveen Thumbikat et al.
PLoS pathogens, 5(5), e1000415-e1000415 (2009-05-05)
Urinary tract infections are the second most common infectious disease in humans and are predominantly caused by uropathogenic E. coli (UPEC). A majority of UPEC isolates express the type 1 pilus adhesin, FimH, and cell culture and murine studies demonstrate

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique