Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU006301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dusp6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTCCAACCAGAACGTCTACCAGGTGGACTCCCTGCAGTCTACGTGAAAGGCACCCACCTCTCCTAGCCGGGAGTTGTCCCCATTCCTTCAGTTCCTCTTGAGCAGCATCGACCAGGCTGCTTTCTTTCTGTGTGTGGCCCCGGGTGTCAAAAGTGTCACCAGCTGTCTGTGTTAGACAAGGTTGCCAAGTGCAAAATTGGTTATTACGGAGGGAGAGATTTGCTCCATTCATTGTTTTTTTGGAAGGACAGGACATGCTGTCTCTAGATCCAGCAATAGGTTTGCTTCTGTACCCCAGCCTACCCAAGCAGGGACTGGACATCCATCCAGATAGAGGGTAGCATAGGAATAGGGACAGGAGCATCTGTTCTTTAAGGCCTTGTATGGCTGTTTCCTGTTGCATCTGGA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline
Yifan Gu et al.
International journal of clinical and experimental medicine, 8(6), 8590-8598 (2015-08-27)
MicroRNAs (miRNAs) are small, non-coding RNAs that modulate gene expression by negatively regulating the stability or translational efficiency of their target mRNAs. The aim of this study was to investigate the expression of microRNA-145 (miR-145) in human papillary thyroid cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique