Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU158351

Sigma-Aldrich

MISSION® esiRNA

targeting human PMEPA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGTGCCTAGCTTGGTGAGGTTACTCCTGCTCCTCCAACCTTTTTTTGCCAAGGTTTGTACACGACTCCCATCTAGGCTGAAAACCTAGAAGTGGACCTTGTGTGTGTGCATGGTGTCAGCCCAAAGCCAGGCTGAGACAGTCCTCATATCCTCTTGAGCCAAACTGTTTGGGTCTCGTTGCTTCATGGTATGGTCTGGATTTGTGGGAATGGCTTTGCGTGAGAAAGGGGAGGAGAGTGGTTGCTGCCCTCAGCCGGCTTGAGGACAGAGCCTGTCCCTCTCATGACAACTCAGTGTTGAAGCCCAGTGTCCTCAGCTTCATGTCCAGTGGATGGCAGAAGTTCATGGGGTAGTGGCCTCTCAAAGGCTGGGCGCATCCCAAGACAGCCAGCAGGTTGTCTCTGGAAACGACCAGAGTTAAGCTCTCGGCTTCTCTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Riezki Amalia et al.
Cellular signalling, 59, 24-33 (2019-03-21)
Transmembrane prostate androgen-induced protein (TMEPAI) is a type I transmembrane protein induced by several intracellular signaling pathways such as androgen, TGF-β, EGF, and Wnt signaling. It has been reported that TMEPAI functions to suppress TGF-β and androgen signaling but here
Yuyin Li et al.
Cell proliferation, 49(6), 710-719 (2016-11-04)
TMEPAI (transmembrane prostate androgen-induced protein) has been reported to be overexpressed during tumour progression; however, little is known concerning transcriptional mechanisms regulating TMEPAI gene expression. In this study, the TMEPAI gene promoter has been identified and characterized, and the effects
Noboru Funakubo et al.
Journal of cellular physiology, 233(4), 3105-3118 (2017-08-13)
Osteoclasts are multinucleated cells formed by fusion of preosteoclasts (POCs) derived from cells of the monocyte/macrophage lineage. We have reported a culture system that supports the formation of POCs from stroma-depleted rat bone marrow cells. Global gene expression analysis of
Hua Li et al.
Oncotarget, 6(17), 15137-15149 (2015-04-18)
Androgen Receptor (AR) is the male hormone receptor and a nuclear transcription factor which plays a central role in the growth of normal and malignant prostate gland. Our earlier studies defined a mechanistic model for male hormone dependent regulation of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique