Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU156971

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAATATGCCATCTCACAGCCTCTGGAAGGGGCTGGGGCCACGTGCCCCACAGGGTCAGAGCCCCTGGCAGGAGAGACGCCCAACCAGGCCCTGAAACCCGGGGCAAAATCCAACAGCATCATTGTGAGCCCTCGGCAGAGGGGCAATCCCGTACTGAAGTTCGTGCGCAATGTGCCCTGGGAATTTGGCGACGTAATTCCCGACTATGTGCTGGGCCAGAGCACCTGTGCCCTGTTCCTCAGCCTCCGCTACCACAACCTGCACCCAGACTACATCCATGGGCGGCTGCAGAGCCTGGGGAAGAACTTCGCCTTGCGGGTCCTGCTTGTCCAGGTGGATGTGAAAGATCCCCAGCAGGCCCTCAAGGAGCTGGCTAAGATGTGTATCCTGGCCGACTGCACATTGATCCTCGCCTGGAGCCCCGAGGAAGCTGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAGAAACCAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei-Ping Lee et al.
Biochimica et biophysica acta, 1863(4), 917-928 (2017-01-16)
Gemcitabine and capecitabine are two effective anticancer agents against solid tumors. The pharmacological mechanisms have been known as incorporation into DNA and thereby inhibition of DNA synthesis. When used as metronomic chemotherapy, they may inhibit angiogenesis and induce immunity. In
Jae Joon Han et al.
Cancer research and treatment : official journal of Korean Cancer Association, 46(1), 55-64 (2014-02-13)
The novel heat shock protein tumor necrosis factor receptor-associated protein 1 (TRAP1) is associated with multidrug resistance in colorectal cancer (CRC) cells in vitro. Excision repair cross-complementation group 1 (ERCC1) expression levels in tumor tissues also predict clinical outcomes in
Daniel P Feldmann et al.
Molecules (Basel, Switzerland), 25(8) (2020-04-30)
Platinum-based chemotherapy remains a mainstay treatment for the management of advanced non-small cell lung cancer. A key cellular factor that contributes to sensitivity to platinums is the 5'-3' structure-specific endonuclease excision repair cross-complementation group 1 (ERCC1)/ xeroderma pigmentosum group F
Gianmaria Liccardi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3496-3506 (2014-05-02)
The epidermal growth factor receptor (EGFR) plays an important role in cellular response to chemotherapy and radiotherapy through modulation of DNA repair. EGFR activates DNA-dependent protein kinase (DNA-PK) stimulating repair of DNA strand breaks (SB) and interstrand crosslinks (ICL). We
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique