Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU152001

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCTGATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGGGCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAACATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACATACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGCGAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTCTTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCCCATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Po-Hsiang Chang et al.
Scientific reports, 8, 45751-45751 (2017-04-04)
Cancer stem cells (CSCs), a small population of cancer cells, have been considered to be the origin of cancer initiation, recurrence, and metastasis. Tumor microenvironment provides crucial signals for CSCs to maintain stem cell properties and promotes tumorigenesis. Therefore, establishment
Shawn P Carey et al.
Scientific reports, 7, 42088-42088 (2017-02-12)
A critical step in breast cancer progression is local tissue invasion, during which cells pass from the epithelial compartment to the stromal compartment. We recently showed that malignant leader cells can promote the invasion of otherwise non-invasive epithelial follower cells
Pirita Pekkonen et al.
eLife, 7 (2018-05-02)
Lymphatic invasion and lymph node metastasis correlate with poor clinical outcome in melanoma. However, the mechanisms of lymphatic dissemination in distant metastasis remain incompletely understood. We show here that exposure of expansively growing human WM852 melanoma cells, but not singly
Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique