Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU151881

Sigma-Aldrich

MISSION® esiRNA

targeting human SCN5A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACGCCTTGTATGTCCTCAGTCCCTTCCACCCCATCCGGAGAGCGGCTGTGAAGATTCTGCTTTCCTTGACCCCACGCACGCTCTTCAACATGCTCATCATGTGCACCATCCTCACCAACTGCGTGTTCATGGCCCAGCACGACCCTCCACCCTGGACCAAGTATGTCGAGTACACCTTCACCGCCATTTACACCTTTGAGTCTCTGGTCAAGATTCTGGCTCGAGGCTTCTGCCTGCACGCGTTCACTTTCCTTCGGGACCCATGGAACTGGCTGGACTTTAGTGTGATTATCATGGCATACACAACTGAATTTGTGGACCTGGGCAATGTCTCAGCCTTACGCACCTTCCGAGTCCTCCGGGCCCTGAAAACTATATCAGTCATTTCAGGGCTGAAGACCATCGTGGGGGCCCTGATCCAGTCTGTGAAGAAGCTGGCTGATG

Numéro d'accès Ensembl | humain

ENSG00000183873

Numéro d'accès NCBI

NM_000335

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SCN5A(6331) , SCN5A(6331)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
WNS
QCS
DOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wan-Lin Lo et al.
Nature immunology, 13(9), 880-887 (2012-07-31)
The sustained entry of Ca(2+) into CD4(+)CD8(+) double-positive thymocytes is required for positive selection. Here we identified a voltage-gated Na(+) channel (VGSC) that was essential for positive selection of CD4(+) T cells. Pharmacological inhibition of VGSC activity inhibited the sustained
Jie Zhang et al.
Acta biochimica et biophysica Sinica, 51(6), 562-570 (2019-05-30)
The protein voltage-gated sodium channel Nav1.5 is highly upregulated in various types of cancer and, in general, promotes cancer cell invasiveness and metastatic progression. A previous study found that Nav1.5 was highly expressed in poorly differentiated oral squamous cell carcinoma
Ming Yang et al.
Journal of cellular physiology, 235(4), 3950-3972 (2019-10-16)
Ion channels can regulate the plasma membrane potential (Vm ) and cell migration as a result of altered ion flux. However, the mechanism by which Vm regulates motility remains unclear. Here, we show that the Nav 1.5 sodium channel carries

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique