Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU146001

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wang Lili et al.
Experimental biology and medicine (Maywood, N.J.), 244(9), 734-742 (2019-05-02)
The mechanism of gastric cancer is highly complex, accompanied by a variety of genetic abnormalities. It is of great significance to elucidate the pathogenesis of gastric cancer, find its markers and therapeutic targets in the fight against this fatal disease.
Hengli Zhao et al.
Scientific reports, 6, 23286-23286 (2016-03-17)
Blockading P2X7 receptor(P2X7R) provides neuroprotection toward various neurological disorders, including stroke, traumatic brain injury, and subarachnoid hemorrhage. However, whether and how P2X7 receptor suppression protects blood-brain barrier(BBB) after intracerebral hemorrhage(ICH) remains unexplored. In present study, intrastriatal autologous-blood injection was used
Shu Guan et al.
Frontiers in psychiatry, 10, 770-770 (2019-11-05)
Diabetic neuropathic pain (DNP) and major depressive disorder (MDD) are common complications of diabetes mellitus and mutually affect each other. As a member of the ATP-gated ion channel family, P2X7 receptor is associated with the transduction of pain signal and
Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular
Miso Park et al.
Scientific reports, 9(1), 11587-11587 (2019-08-14)
Tamoxifen (TAM) is the standard anti-hormonal therapy for estrogen receptor-positive breast cancer. However, long-term TAM therapy can make acquisition of TAM resistance and there are still no solutions to treat TAM-resistant breast cancer. In this study, we found that protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique