Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU144441

Sigma-Aldrich

MISSION® esiRNA

targeting human SNX5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTCGCTTCAGATTGACATACCTGATGCGCTCAGTGAGAGAGACAAAGTCAAATTTACAGTGCACACAAAGACCACACTGCCCACGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTTATTGAAACAACAGACTATGCTGGGCTTATTATTCCACCTGCTCCTACGAAGCCCGACTTTGATGGTCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGTGAAGGGTCTATGACCAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCTGAGTATCTCGCTGTGTTTAAGAAGACTGTGTCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGATCGCAACTTTCATGTTTTCCTGGAATATGATCAGGATCTAAGTGTTAGGCGGAAAAATACTAAAGAGATGTTTGGTGGCTTCTTCAAA

Numéro d'accès Ensembl | humain

ENSG00000089006

Numéro d'accès NCBI

NM_014426

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SNX5(27131) , SNX5(27131)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nao Itai et al.
PloS one, 13(11), e0207205-e0207205 (2018-11-13)
Sorting nexin 5 (SNX5), a member of sorting nexin family, plays an important role in membrane trafficking, including the retrograde trafficking of the cation independent mannose 6-phosphate receptor (CI-M6PR) and macropinocytosis. Using ESI-LCMS/MS analysis, we confirmed that SNX5 serine 226
Jinyang Cai et al.
Journal of Cancer, 10(13), 2942-2952 (2019-07-10)
Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide. Long-term survival rates in patients with HNSCC have not increased significantly in the past 30 years. Therefore, looking for novel molecular targets that control HNSCC progression
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique