Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU143141

Sigma-Aldrich

MISSION® esiRNA

targeting human SPINT2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTCAAGAAATGTGCCACTGTCACAGAGAATGCCACGGGTGACCTGGCCACCAGCAGGAATGCAGCGGATTCCTCTGTCCCAAGTGCTCCCAGAAGGCAGGATTCTGAAGACCACTCCAGCGATATGTTCAACTATGAAGAATACTGCACCGCCAACGCAGTCACTGGGCCTTGCCGTGCATCCTTCCCACGCTGGTACTTTGACGTGGAGAGGAACTCCTGCAATAACTTCATCTATGGAGGCTGCCGGGGCAATAAGAACAGCTACCGCTCTGAGGAGGCCTGCATGCTCCGCTGCTTCCGCCAGCAGGAGAATCCTCCCCTGCCCCTTGGCTCAAAGGTGGTGGTTCTGGCGGGGCTGTTCGTGATGGTGTTGATCCTCTTCCTGGGAGCCTCCATGGTCTACCTGATCCGGGTGGCACGGAGGAACCAGGAGCGTGCCCTGCGCACCGTCTGGAGCTCCGGAGATGACAAGGAGCAGCTGGTGAAGAA

Numéro d'accès Ensembl | humain

ENSG00000167642

Numéro d'accès NCBI

NM_021102

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SPINT2(10653) , SPINT2(10653)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fernanda Marconi Roversi et al.
Journal of cellular and molecular medicine, 23(2), 1562-1571 (2018-11-30)
The role of tumour microenvironment in neoplasm initiation and malignant evolution has been increasingly recognized. However, the bone marrow mesenchymal stromal cell (BMMSC) contribution to disease progression remains poorly explored. We previously reported that the expression of serine protease inhibitor
Soonyean Hwang et al.
The Journal of investigative dermatology, 135(9), 2283-2291 (2015-04-25)
Aberrant HGF-MET (hepatocyte growth factor-met proto-oncogene) signaling activation via interactions with surrounding stromal cells in tumor microenvironment has significant roles in malignant tumor progression. However, extracellular proteolytic regulation of HGF activation, which is influenced by the tumor microenvironment, and its
Chuan-Jin Wu et al.
The Journal of clinical investigation, 127(2), 623-634 (2017-01-18)
Congenital tufting enteropathy (CTE) is a severe autosomal recessive human diarrheal disorder with characteristic intestinal epithelial dysplasia. CTE can be caused by mutations in genes encoding EpCAM, a putative adhesion molecule, and HAI-2, a cell surface protease inhibitor. A similar

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique