Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU141181

Sigma-Aldrich

MISSION® esiRNA

targeting human MPRIP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTAAAATTAGGCCAGCAGTGGGGGCTGGGAGGGCATCTGTGTTAGTCCTTTCCTGGCTGTGACCCGCCACACTCACTGTCAGTATTAAGGCCCAGCAGCCTGTTGATAAGCTACCCTGTCTCACCATGTGCTGGTGTGGAAACGGGGCCCAGCCAGCACGCCTCAAGGTAGATGGAATCCCCACTGGTCAGAGAAAAAGCTATGCGGACACTCCAGCTTGGCCTGGGTCACAGCACTGACTCCTCACCCGCTAGTCTGGCTGTTAAGAGGAGAAAGTGCACTGCCTTCCAGCCCAGGAGGAGGACAGCATTTTGTATTTGTTCCACTGATGCAGCTTAGAACCACACCCCTGAGAGTCGTGGCAAACCTTTCACAACCTGGAAAATGTTGAAAGCAACCA

Numéro d'accès Ensembl | humain

ENSG00000133030

Numéro d'accès NCBI

NM_015134

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MPRIP(23164) , MPRIP(23164)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shinichi Nakamuta et al.
The Journal of cell biology, 216(12), 4313-4330 (2017-11-02)
Throughout life, stem cells in the ventricular-subventricular zone generate neuroblasts that migrate via the rostral migratory stream (RMS) to the olfactory bulb, where they differentiate into local interneurons. Although progress has been made toward identifying extracellular factors that guide the
Min Zhang et al.
PloS one, 10(5), e0127386-e0127386 (2015-05-23)
Death signaling provided by tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) can induce death in cancer cells with little cytotoxicity to normal cells; this cell death has been thought to involve caspase-dependent apoptosis. Reactive oxygen species (ROS) are also mediators

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique