Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU141161

Sigma-Aldrich

MISSION® esiRNA

targeting human PPM1G

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAGGGAAGCAGTTGATTGTAGCCAACGCAGGAGACTCTCGCTGTGTGGTATCTGAGGCTGGCAAAGCTTTAGACATGTCCTATGATCACAAACCAGAGGATGAAGTAGAACTAGCACGCATCAAGAATGCTGGTGGCAAGGTCACCATGGATGGGCGAGTCAACGGGGGCCTCAACCTCTCCAGAGCCATTGGGGACCACTTCTATAAGAGAAACAAGAACCTGCCACCTGAGGAACAGATGATTTCAGCCCTTCCTGACATCAAGGTGCTGACTCTCACTGACGACCATGAATTCATGGTCATTGCCTGTGATGGCATCTGGAATGTGATGAGCAGCCAGGAAGTTGTAGATTTCATTCAATCAAAGATCAGCCAGCGTGATGAAAATGGGGAGCTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kuai Yu et al.
Science advances, 6(47) (2020-11-22)
The adaptor proteins, STING and MAVS, are components of critical pathogen-sensing pathways that induce innate immunity. Phosphorylation of either adaptor results in activation of the type I interferon pathway. How this phosphorylation is regulated and how it is manipulated by
Swapna Aravind Gudipaty et al.
Molecular and cellular biology, 35(22), 3810-3828 (2015-09-02)
Transcription elongation programs are vital for the precise regulation of several biological processes. One key regulator of such programs is the P-TEFb kinase, which phosphorylates RNA polymerase II (Pol II) once released from the inhibitory 7SK small nuclear ribonucleoprotein (snRNP)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique