Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU138091

Sigma-Aldrich

MISSION® esiRNA

targeting human FUNDC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGAGTGTTTGGCCACAGTTCGGGACCTATGGTAGAAAAATACTCAGTAGCTACCCAGATTGTAATGGGTGGCGTTACTGGCTGGTGTGCAGGATTTCTGTTCCAGAAAGTTGGAAAACTTGCAGCAACTGCAGTAGGTGGTGGCTTTCTTCTTCTTCAGATTGCTAGTCATAGTGGCTATGTGCAGATTGACTGGAAGAGAGTTGAAAAAGATGTAAATAAAGCAAAAAGACAGATTAAGAAACGAGCGAACAAAGCAGCACCTGAAATCAACAATTTAATTGAAGAAGCAACAGAATTTATCAAGCAGAACATTGTGATATCCAGTGGATTTGTGGGAGGCTTTTTGCTCGGACTTGCATCTTAAGGACATGAATATTCTCCCATAACGGATTCAACTATGAGAAGAGAAGTGGCAGCAATAAGGCAGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hao Zhou et al.
Basic research in cardiology, 113(4), 23-23 (2018-05-11)
Mitochondrial fission and mitophagy are considered key processes involved in the pathogenesis of cardiac microvascular ischemia reperfusion (IR) injury although the upstream regulatory mechanism for fission and mitophagy still remains unclear. Herein, we reported that NR4A1 was significantly upregulated following
L Hui et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(5), 596-606 (2018-10-05)
The purpose of our study was to investigate an underlying mechanism that hydrogen peroxide-induced mitophagy contributed to laryngeal cancer cells survivals under oxidative stress condition. Tumor tissue and serum samples were collected from patients with laryngeal cancer. The Hep2 cell

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique