Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU137921

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Numéro d'accès Ensembl | humain

ENSG00000140575

Numéro d'accès NCBI

NM_003870

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IQGAP1(8826) , IQGAP1(8826)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Ana C Alcalá et al.
The Journal of general virology, 98(8), 2088-2099 (2017-08-02)
Dengue virus NS1 is a glycoprotein of 46-50 kDa that is conserved among flaviviruses, associates as a dimer to cell membranes and is secreted as a hexamer to the extracellular milieu. Recent evidence showed that NS1 is secreted efficiently from infected
Aaron M Tocker et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2896-2909 (2017-09-03)
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers
Niramol Jitprasutwit et al.
Journal of proteome research, 15(12), 4675-4685 (2016-12-10)
Intracellular actin-based motility of the melioidosis pathogen Burkholderia pseudomallei requires the bacterial factor BimA. Located at one pole of the bacterium, BimA recruits and polymerizes cellular actin to promote bacterial motility within and between cells. Here, we describe an affinity
Bhavna Chawla et al.
The Journal of biological chemistry, 292(8), 3273-3289 (2017-01-14)
Insulin binds to the insulin receptor (IR) and induces tyrosine phosphorylation of the receptor and insulin receptor substrate-1 (IRS-1), leading to activation of the PKB/Akt and MAPK/ERK pathways. IQGAP1 is a scaffold protein that interacts with multiple binding partners and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique