Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU137721

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC

Numéro d'accès Ensembl | humain

ENSG00000107485

Numéro d'accès NCBI

NM_001002295

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GATA3(2625) , GATA3(2625)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Mei Xu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(11), 3605-3617 (2018-09-27)
p38γ is a member of p38 MAPK family which contains four isoforms p38α, p38β, p38γ, and p38δ. p38γ MAPK has unique function and is less investigated. Recent studies revealed that p38γ MAPK may be involved in tumorigenesis and cancer aggressiveness.
P Shahi et al.
Oncogene, 36(40), 5567-5575 (2017-06-06)
Semaphorin 3B (SEMA3B) is a secreted axonal guidance molecule that is expressed during development and throughout adulthood. Recently, SEMA3B has emerged as a tumor suppressor in non-neuronal cells. Here, we show that SEMA3B is a direct target of GATA3 transcriptional
Shuangqin Wei et al.
Cancer management and research, 9, 769-780 (2017-12-22)
GATA3, a member of the GATA zinc finger transcription factor family, has been widely investigated for its role in cancer. Although a recent report has found that GATA3 is downregulated in gastric cancer (GC), the detailed mechanism of GATA3 in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique