Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU134211

Sigma-Aldrich

MISSION® esiRNA

targeting human HRAS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCAGGAGACCCTGTAGGAGGACCCCGGGCCGCAGGCCCCTGAGGAGCGATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Satoshi Sugita et al.
International journal of oncology, 53(2), 725-736 (2018-06-15)
The active form of the small GTPase RAS binds to downstream effectors to promote cell growth and proliferation. RAS signal enhancement contributes to tumorigenesis, invasion, and metastasis in various different cancers. HRAS proto-oncogene GTPase (HRAS), one of the RAS isoforms
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique