Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU131091

Sigma-Aldrich

MISSION® esiRNA

targeting human KL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAATGACCGACCACAGCATCAAAGAATGTCAAAAATCTCTGGACTTTGTACTAGGTTGGTTTGCCAAACCCGTATTTATTGATGGTGACTATCCCGAGAGCATGAAGAATAACCTTTCATCTATTCTGCCTGATTTTACTGAATCTGAGAAAAAGTTCATCAAAGGAACTGCTGACTTTTTTGCTCTTTGCTTTGGACCCACCTTGAGTTTTCAACTTTTGGACCCTCACATGAAGTTCCGCCAATTGGAATCTCCCAACCTGAGGCAACTGCTTTCCTGGATTGACCTTGAATTTAACCATCCTCAAATATTTATTGTGGAAAATGGCTGGTTTGTCTCAGGGACCACCAAGAGAGATGATGCCAAATATATGTATTACCTCAAAAAGTTCATCATGGAAACCTTAAAAGCCATCAAGCTGGATGGGGTGGATGTCATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGT

Numéro d'accès Ensembl | humain

ENSG00000133116

Numéro d'accès NCBI

NM_004795

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KL(9365) , KL(9365)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lin Chen et al.
PloS one, 8(3), e58413-e58413 (2013-03-22)
Klotho was originally characterized as an aging suppressor gene that predisposed Klotho-deficient mice to premature aging-like syndrome. Although Klotho was recently reported to exhibit tumor suppressive properties during various malignant transformations, the functional role and molecular mechanism of Klotho in
Xiaowei Tang et al.
Laboratory investigation; a journal of technical methods and pathology, 96(2), 197-205 (2015-08-04)
Klotho, an anti-aging gene, has recently been shown to contribute to human hepatic tumorigenesis. In addition, it is known that Wnt signaling is antagonized by the protein klotho. Because augmented Wnt signaling has an important role in tumorigenesis of human
Youliang Yan et al.
Molecular medicine reports, 15(4), 1777-1785 (2017-03-06)
Klotho is a recently discovered anti‑aging gene, which has been reported as a tumor suppressor in numerous human malignancies; however, the role of Klotho in human ovarian cancer remains to be elucidated. The aim of the present study was to
Jinpeng Hu et al.
Experimental and therapeutic medicine, 21(5), 486-486 (2021-04-02)
Early reperfusion is the most effective and important treatment for acute myocardial infarction. However, reperfusion therapy often leads to a certain degree of myocardial damage. The aim of the present study was to identify the role of klotho, and the
Lina Xing et al.
Life sciences, 269, 119068-119068 (2021-01-22)
Podocyte apoptosis plays an important role in the pathogenesis of diabetic nephropathy (DN). Astragaloside IV (AS-IV) has been shown to protect against podocyte apoptosis. Here we aim to investigate the mechanism responsible for the protective effects of AS-IV. Diabetic db/db
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique