Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU120541

Sigma-Aldrich

MISSION® esiRNA

targeting human VTN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAATGAGCCTTCTTTCTGCCCTCCAGATCCACGGTGCTAATTCCCCTTCCGATGACCTAATGATTCTGAGCTTGGCAAAGGTCTTATCTCCCAGCTCGCCCAGGCCCAGTGTTCCAGGAATGTGACCTTTGCTGCAGCAGCCGCTGGAGGGGGCAGAGGGGATGGGCTGGAGGTTGAGCAAACAGAGCAGCAGAAAAGGCAGTTCCTCTTCTCCAGTGCCCTCCTTCCCTGTCTCTGCCTCTCCCTCCCTTCCTCAGGCATCAGAGCGGAGACTTCAGGGAGACCAGAGCCCAGCTTGCCAGGCACTGAGCTAGAAGCCCTGCCATGGCACCCCTGAGACCCCTTCTCATACTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGAGTCATGCAAGGGCCGCTGCACTGAGGGCTTCAACGTGGACAAGAAGTGCCAGTGTGACGAGCTCTGCTCTTACTACCAGAGCTGCTGCACAG

Numéro d'accès Ensembl | humain

ENSG00000109072

Numéro d'accès NCBI

NM_000638

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VTN(7448)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hilary A Kenny et al.
The Journal of clinical investigation, 124(10), 4614-4628 (2014-09-10)
Ovarian cancer (OvCa) metastasizes to organs in the abdominal cavity, such as the omentum, which are covered by a single layer of mesothelial cells. Mesothelial cells are generally thought to be "bystanders" to the metastatic process and simply displaced by
Masaki Ikeda et al.
BMC microbiology, 15, 263-263 (2015-11-18)
Nontypeable Haemophilus influenzae (NTHi) is one of the most common Gram-negative pathogens in otitis media and exacerbation of chronic obstructive pulmonary disease. NTHi has been reported to invade bronchial epithelial cells. This penetration enables NTHi to evade the host immune

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique