Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU119261

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGAGGTCAGTAGTTTAAAAGTTCTTAGTTATATAGCATCTGGAAGATCATTTTGAAATTGTTCCTTGGAGAAATGAAAACAGTGTGTAAACAAAATGAAGCTGCCCTAATAAAAAGGAGTATACAAACATTTAAGCTGTGGTCAAGGCTACAGATGTGCTGACAAGGCACTTCATGTAAAGTGTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qian Zhang et al.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, 34(4), 606-617 (2018-07-10)
Secondary hyperparathyroidism (SHPT) in patients with end-stage renal disease (ESRD) is characterized by hyperplasia of the parathyroid glands (PTGs), while the underlying mechanism is not completely understood. Previously we demonstrated a relationship between cyclooxygenase 2 (COX2) overexpression and parathyroid hyperplasia
Jigisha A Patel et al.
International journal of molecular sciences, 19(8) (2018-08-15)
Prostacyclins are extensively used to treat pulmonary arterial hypertension (PAH), a life-threatening disease involving the progressive thickening of small pulmonary arteries. Although these agents are considered to act therapeutically via the prostanoid IP receptor, treprostinil is the only prostacyclin mimetic
Fusako Sakai-Takemura et al.
Communications biology, 3(1), 182-182 (2020-04-22)
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique