Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Jiajia Chen et al.
Neuropeptides, 61, 67-76 (2016-11-12)
Annexin A2 (ANXA2), is a member of the annexin family of proteins that exhibit Ca
Zhiyang Wang et al.
Journal of cellular and molecular medicine, 22(1), 429-438 (2017-09-01)
Tenascin-c is an extracellular matrix glycoprotein, the expression of which relates to the progression of atherosclerosis, myocardial infarction and heart failure. Annexin II acts as a cell surface receptor of tenascin-c. This study aimed to delineate the role of tenascin-c
Yuanhong Chang et al.
Oncology reports, 40(6), 3625-3634 (2018-10-03)
Recently, long non-coding RNA (lncRNA) FOXD2 adjacent opposite strand RNA 1 (FOXD2-AS1) has been recognized to function as an oncogene in several human tumors, and FOXD2‑AS1 dysregulation has been closely associated with carcinogenesis and tumor progression. Nevertheless, the correlation between the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique