Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU115561

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6A (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGTCGTATCAGCAGGAAATCTTCTAAGCCATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGGAGCAGAACACCAGGTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGCCCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTCTGTGAAAAAAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTTTATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATAAATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAATGTTGGTCCACT

Numéro d'accès Ensembl | humain

ENSG00000147050

Numéro d'accès NCBI

NM_021140

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KDM6A(7403) , UTX(7404)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rintaro Hashizume et al.
Nature medicine, 20(12), 1394-1396 (2014-11-18)
Pediatric brainstem gliomas often harbor oncogenic K27M mutation of histone H3.3. Here we show that GSKJ4 pharmacologic inhibition of K27 demethylase JMJD3 increases cellular H3K27 methylation in K27M tumor cells and demonstrate potent antitumor activity both in vitro against K27M
Hongya Han et al.
PloS one, 9(1), e85085-e85085 (2014-01-28)
Arachidonate 15-lipoxygenase-1 (ALOX15) oxygenates polyunsaturated fatty acids and bio-membranes, generating multiple lipid signalling mediators involved in inflammation. Several lines of evidence indicate that ALOX15 activation in the respiratory tract contributes to asthma progression. Recent experimental data reveals that histone modification
Rakel Brendsdal Forthun et al.
PloS one, 7(11), e48992-e48992 (2012-11-17)
The mechanisms of successful epigenetic reprogramming in cancer are not well characterized as they involve coordinated removal of repressive marks and deposition of activating marks by a large number of histone and DNA modification enzymes. Here, we have used a
Shayesta Seenundun et al.
The EMBO journal, 29(8), 1401-1411 (2010-03-20)
Polycomb (PcG) and Trithorax (TrxG) group proteins act antagonistically to establish tissue-specific patterns of gene expression. The PcG protein Ezh2 facilitates repression by catalysing histone H3-Lys27 trimethylation (H3K27me3). For expression, H3K27me3 marks are removed and replaced by TrxG protein catalysed
Di Yang et al.
Journal of cellular biochemistry, 116(11), 2628-2636 (2015-04-29)
Alteration of methylation status of lysine 27 on histone H3 (H3K27) associates with dramatic changes in gene expression in response to various differentiation signals. Demethylation of H3K27 is controlled by specific histone demethylases including ubiquitously transcribed tetratricopeptide repeat X chromosome

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique