Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU113561

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGTGTCGAGATGGCTATGAACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCGACCCTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACGGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAATGTGAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoyuan Wang et al.
Stem cell research & therapy, 9(1), 327-327 (2018-11-25)
Lung cancer stem cells have the ability to self-renew and are resistant to conventional chemotherapy. MicroRNAs (miRNAs) regulate and control the expression and function of many target genes; therefore, miRNA disorders are involved in the pathogenesis of human diseases, such
Rulan Bai et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3371-3384 (2018-02-03)
Embryo implantation into the uterine endometrium is required for pregnancy establishment in most mammals. By using global expression analysis, we investigated the molecules that are related to epithelial-mesenchymal transition (EMT) in noninvasive bovine trophoblasts and found that the transcription factor
Mercedes Tomé et al.
Stem cell research, 35, 101390-101390 (2019-02-15)
Notch signalling regulates neural stem cell (NSC) proliferation, differentiation and survival for the correct development and functioning of the central nervous system. Overactive Notch2 signalling has been associated with poor prognosis of aggressive brain tumours, such as glioblastoma multiforme (GBM).
Jie Deng et al.
Journal of experimental & clinical cancer research : CR, 38(1), 2-2 (2019-01-05)
Glioblastomas multiforme (GBM) is the most devastating primary intracranial malignancy lacking effective clinical treatments. Notch2 has been established to be a prognostic marker and probably involved in GBM malignant progression. N-acetylcysteine (NAC), a precursor of intracellular glutathione (GSH), has been
Jeeranan Manokawinchoke et al.
Scientific reports, 7(1), 10124-10124 (2017-09-02)
Notch signaling regulates diverse biological processes in dental pulp tissue. The present study investigated the response of human dental pulp cells (hDPs) to the indirect immobilized Notch ligand Jagged1 in vitro. The indirect immobilized Jagged1 effectively activated Notch signaling in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique