Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU110481

Sigma-Aldrich

MISSION® esiRNA

targeting human U2AF1, U2AF1L5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATTGCCCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGTTTGCGCTGTGCCGTGAGCGATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAGGAGGTTTTTACAGAAATGGAGGAGAAGTATGGGGAAGTAGAGGAGATGAACGTCTGTGACAACCTGGGAGACCACCTGGTGGGGAACGTGTACGTCAAGTTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAATGGACAGCCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGTCAGTATGAGATGGGAGAATGCACACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAG

Numéro d'accès Ensembl | humain

ENSG00000160201

Numéro d'accès NCBI

NM_006758

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... U2AF1(102724594) , U2AF1(7307)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Olga Herdt et al.
RNA (New York, N.Y.), 23(12), 1796-1806 (2017-09-13)
Recent work has identified cancer-associated U2AF35 missense mutations in two zinc-finger (ZnF) domains, but little is known about Q157R/P substitutions within the second ZnF. Surprisingly, we find that the c.470A>G mutation not only leads to the Q157R substitution, but also
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique