Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU109691

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTATGAAGCCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAATGGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTCCAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGTCCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAACACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACTGTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Patricia Dauer et al.
Molecular oncology, 12(9), 1498-1512 (2018-05-09)
Chemoresistance is a major therapeutic challenge that plays a role in the poor statistical outcomes in pancreatic cancer. Unfolded protein response (UPR) is one of the homeostasis mechanisms in cancer cells that have been correlated with chemoresistance in a number
Kyung-Won Park et al.
Scientific reports, 7, 44723-44723 (2017-03-24)
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein
Jijun Wang et al.
Neurochemical research, 43(9), 1736-1744 (2018-07-02)
A growing body of literature has established a link between the cerebral ischaemic injury and pathological state of Alzheimer's disease (AD), and this correlation indicated that the preventive agent for ischaemia might improve the pathology of AD. Our previous studies
Haopeng Yang et al.
Oncotarget, 7(50), 83641-83656 (2016-11-16)
Pancreatic cancer is a highly aggressive malignancy, which is intrinsically resistant to current chemotherapies. Herein, we investigate whether bisdemethoxycurcumin (BDMC), a derivative of curcumin, potentiates gemcitabine in human pancreatic cancer cells. The result suggests that BDMC sensitizes gemcitabine by inducing
Hiroshi Kokubun et al.
International journal of molecular sciences, 21(2) (2020-01-16)
Preclinical studies have shown that exposure of the developing brain to inhalational anesthetics can cause neurotoxicity. However, other studies have claimed that anesthetics can exert neuroprotective effects. We investigated the mechanisms associated with the neurotoxic and neuroprotective effects exerted by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique