Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU109561

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGACTTCTTACCCACCAGGCTGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAGACCCGCAGCAACCCTGAGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTGCTGACCACACTCACCCCAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCCAAGGGCAAGATCACCTTCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGACAAGGCAAGAATCACAAGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAATGAGAAGGATCTGGTGAAACTGGCTAAACGCCTCAAGA

Numéro d'accès Ensembl | humain

ENSG00000159352

Numéro d'accès NCBI

NM_002810

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PSMD4(5710) , PSMD4(5710)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pere Dosta et al.
Cardiovascular engineering and technology, 12(1), 114-125 (2021-01-22)
Endothelial cell (EC) dysfunction underlies the pathology of multiple disease conditions including cardiovascular and pulmonary diseases. Dysfunctional ECs have a distinctive gene expression profile compared to healthy ECs. RNAi therapy is a powerful therapeutic approach that can be used to
Ai-Guo Ma et al.
The Kaohsiung journal of medical sciences, 35(10), 591-597 (2019-06-05)
Proteasome 26S subunit non-ATPase 4 (PSMD4) is an important proteasome ubiquitin receptor and plays a key role in endoplasmic reticulum stress (ERS). However, the study of PSMD4 in esophageal cancer (EC) is relatively rare. Here, we found that the expression
Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A
Lin Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 22(12), 1079-1087 (2015-11-10)
Dihydrotanshinone I (DHTS) was previously reported to exhibit the most potent anti-cancer activity among several tanshinones in colon cancer cells. Its cytotoxic action was reactive oxygen species (ROS) dependent but p53 independent. To further study the anti-cancer activity of DHTS
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique