Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU095101

Sigma-Aldrich

MISSION® esiRNA

targeting human NRG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCATCACCCTCAGCAGTTCAGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGGATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTTAAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAACAGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAAGATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Youya Wang et al.
Journal of thoracic disease, 10(6), 3166-3179 (2018-08-03)
Neuregulin1 (NRG1) is critical signaling protein that mediates the activation of downstream signaling pathways associated with malignancies. Multiple gene fusions related to NRG1 have been found in lung cancer. However, the underlying role NRG1 in lung cancer is yet unclear.
K Yonesaka et al.
Oncogene, 35(7), 878-886 (2015-05-12)
Human epidermal growth factor receptor (HER) 3 is aberrantly overexpressed and correlates with poor prognosis in non-small cell lung cancer (NSCLC). Patritumab is a monoclonal antibody against HER3 that has shown promising results in early-phase clinical trials, but an optimal
Alessandra Bolino et al.
EMBO molecular medicine, 8(12), 1438-1454 (2016-11-02)
Charcot-Marie-Tooth (CMT) neuropathies are highly heterogeneous disorders caused by mutations in more than 70 genes, with no available treatment. Thus, it is difficult to envisage a single suitable treatment for all pathogenetic mechanisms. Axonal Neuregulin 1 (Nrg1) type III drives

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique