Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU093851

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGACTTGTGGGTGCTCCTGGCTCAACCCAACCAACAGGACTGACTGACTGGCAGGACAAGGTCTGGCATGGCACAGCACCACTGCCAGGCCTCCCCAGGCACACCACTCTGCCCAGGGAATGGGGGCTTTGGGTCATCTCCCACTGCCTGGGGGAGTCAGATGGGGTGCAGGAATCTGGCTCTTCAGCCATCTCAGGTTTAGGGGGTTTGTAACAGACATTATTCTGTTTTCACTGCGTATCCTTGGTAAGCCCTGTGGACTGGTTCCTGCTGTGTGATGCTGAGGGTTTTAAGGTGGGGAGAGATAAGGGCTCTCTCGGGCCATGCTACCCGGTATGACTGGGTAATGAGGACAGACTGTGGACACCCCATCTACCTGAGTCTGATTCTTTAGCAGCAGAGACTGAGGGGTGCAGAGTGT

Numéro d'accès Ensembl | humain

ENSG00000064547

Numéro d'accès NCBI

NM_004720

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LPAR2(9170) , LPAR2(9170)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zi Wang et al.
Journal of molecular medicine (Berlin, Germany), 98(12), 1781-1794 (2020-11-01)
Autotaxin (ATX) is a secreted enzyme that hydrolyzes lysophosphatidylcholine (LPC) to lysophosphatidic acid (LPA) and choline. ATX has been implicated in multiple chronic inflammatory diseases, but little is known about its role in the development of inflammatory bowel disease (IBD).
Ying Zhang et al.
OncoTargets and therapy, 13, 4145-4155 (2020-06-12)
The dysregulation of the human papillomavirus 18 E6 and E7 oncogenes plays a critical role in the angiogenesis of cervical cancer (CC), including the proliferation, migration, and tube formation of vascular endothelial cells. Interfering E6/E7 increases the number of CC
Simon McArthur et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 1139-1151 (2015-06-24)
Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique