Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU093811

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGCCATTCCTCATGTCAAATATTTGGATTTGACAAACAATAGACTAGACTTTGATAATGCTAGTGCTCTTACTGAATTGTCCGACTTGGAAGTTCTAGATCTCAGCTATAATTCACACTATTTCAGAATAGCAGGCGTAACACATCATCTAGAATTTATTCAAAATTTCACAAATCTAAAAGTTTTAAACTTGAGCCACAACAACATTTATACTTTAACAGATAAGTATAACCTGGAAAGCAAGTCCCTGGTAGAATTAGTTTTCAGTGGCAATCGCCTTGACATTTTGTGGAATGATGATGACAACAGGTATATCTCCATTTTCAAAGGTCTCAAGAATCTGACACGTCTGGATTTATCCCTTAATAGGCTGAAGCACATCCCAAATGAAGCATTCCTTAATTTGCCAGCGAGTCTCACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

G Comito et al.
Oncogene, 38(19), 3681-3695 (2019-01-22)
Leukocyte infiltration plays an active role in controlling tumor development. In the early stages of carcinogenesis, T cells counteract tumor growth. However, in advanced stages, cancer cells and infiltrating stromal components interfere with the immune control and instruct immune cells
Huanle Luo et al.
Antiviral research, 151, 55-62 (2018-01-15)
Zika virus (ZIKV) is a mosquito-borne flavivirus associated with severe neonatal birth defects, but the causative mechanism is incompletely understood. ZIKV shares sequence homology and early clinical manifestations with yellow fever virus (YFV) and dengue virus (DENV) and are all
Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique