Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU093011

Sigma-Aldrich

MISSION® esiRNA

targeting human TPX2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCACCAAAGAAGATGAGGAAGAGGACGAACCGGTAGTGATAAAAGCTCAACCTGTGCCACATTATGGGGTGCCTTTTAAGCCCCAAATCCCAGAGGCAAGAACTGTGGAAATATGCCCTTTCTCGTTTGATTCTCGAGACAAAGAACGTCAGTTACAGAAGGAGAAGAAAATAAAAGAACTGCAGAAAGGGGAGGTGCCCAAGTTCAAGGCACTTCCCTTGCCTCATTTTGACACCATTAACCTGCCAGAGAAGAAGGTAAAGAATGTGACCCAGATTGAACCTTTCTGCTTGGAGACTGACAGAAGAGGTGCTCTGAAGGCACAGACTTGGAAGCACCAGCTGGAAGAAGAACTGAGACAGCAGAAAGAAGCAGCTTGTTTCAAGGCTCGTCCAAACACCGTCATCTCTCAGGAGCCCTTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast
Helen Chen et al.
Cell cycle (Georgetown, Tex.), 13(14), 2248-2261 (2014-05-31)
Construction of a mitotic spindle requires biochemical pathways to assemble spindle microtubules and structural proteins to organize these microtubules into a bipolar array. Through a complex with dynein, the receptor for hyaluronan-mediated motility (RHAMM) cross-links mitotic microtubules to provide structural
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique