Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU091961

Sigma-Aldrich

MISSION® esiRNA

targeting human FLI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCC

Numéro d'accès Ensembl | humain

ENSG00000151702

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FLI1(2313) , FLI1(2313)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tao He et al.
Gene, 596, 137-146 (2016-10-30)
A translocation leading to the formation of an oncogenic EWS-ETS fusion protein defines Ewing sarcoma. The most frequent gene fusion, present in 85 percent of Ewing sarcomas, is EWS-FLI1. Here, a high-throughput RNA interference screen was performed to identify genes
Gong-Hong Wei et al.
The EMBO journal, 29(13), 2147-2160 (2010-06-03)
Members of the large ETS family of transcription factors (TFs) have highly similar DNA-binding domains (DBDs)-yet they have diverse functions and activities in physiology and oncogenesis. Some differences in DNA-binding preferences within this family have been described, but they have
T Miyagawa et al.
Journal of the European Academy of Dermatology and Venereology : JEADV, 33(4), 753-760 (2018-12-07)
Trappin-2/pre-elafin is an endogenous inhibitor of human neutrophil elastase involved in inflammation, innate immunity and vascular remodelling, which consist of the complex pathological process of systemic sclerosis (SSc). To clarify the potential role of trappin-2 in SSc. Serum trappin-2 levels
Jonathan P Van Beek et al.
Arthritis research & therapy, 8(2), R36-R36 (2006-02-14)
CCN2 is encoded by an immediate-early gene induced in mesenchymal cells during the formation of blood vessels, bone and connective tissue. It plays key roles in cell adhesion and migration, as well as matrix remodeling. CCN2 is overexpressed in fibrosis
Samer Kayali et al.
PloS one, 7(10), e46799-e46799 (2012-10-12)
Clonal erythroleukemia developing in susceptible mice infected by Friend virus complex are associated with highly recurrent proviral insertions at one of three loci called Spi-1, Fli-1 or Fli-3, leading to deregulated expression of oncogenic Spi-1 or Fli-1 transcription factors or
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique