Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU091151

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TAACGTTCACTGCCCTGTCCAGCGAGAAGAGAGAGAAGCAGGAGGCGTCTGAGTCTCCAGTGAAGGCCGTACAGCCACACATCTCGCCCCTGACCATCAACATTCCAGACACCATGGCCCACCTCATCAGCCCTCTGCCCTCCCCCACGGGAACCATCAGCGCTGCAAACTCCTGCCCCTCCAGCCCCCGGGGAGCGGGGTCTTCAGGGTACAAGGTGGGCCGAGTGATGCCATCTGACCTCAATTTAATGGCTGACAACTCACAGCCTGAAAATGAAAAGGAAGCTTCAGGTGGAGACAGCCCGAAGGATGATTCAAAGCCGCCTTACTCCTACGCGCAGCTGATAGTTCAGGCGATTACGATGGCTCCCGACAAACAGCTCACCCTGAACGGGATTTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dongni Wang et al.
Journal of diabetes and its complications, 33(5), 374-382 (2019-03-14)
MicroRNAs (miRNAs) have emerged as promising regulators of diabetes mellitus (DM)-induced angiogenic dysfunction in endothelial cells (ECs), but information vis-à-vis the functional roles of distinct miRNAs remain surprisingly scarce. The current study was designed to elucidate the expression and function
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique