Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Numéro d'accès Ensembl | humain

ENSG00000048052

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HDAC9(9734) , HDAC9(9734)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is
Yue Yang et al.
The Journal of nutritional biochemistry, 40, 172-177 (2016-12-05)
Activation of hepatic stellate cells (HSCs) is critical for liver fibrosis development. Previously, we showed that astaxanthin (ASTX), a xanthophyll carotenoid, has antifibrogenic effects in LX-2 cells, a human HSC cell line. We sought to determine the effect of ASTX
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Changliang Shan et al.
Cell death & disease, 10(7), 525-525 (2019-07-10)
4-hydroxyphenylpyruvate dioxygenase (HPD) is an important modifier of tyrosine metabolism. However, the precise contribution of HPD to cancer metabolism and tumorigenesis remains unclear. In this study, we found that HPD was highly expressed in lung cancer and its higher expression
Dong-Qin Chen et al.
Therapeutic advances in medical oncology, 10, 1758835918783132-1758835918783132 (2018-07-24)
Treatment of metastatic castration-resistant prostate cancer (mCRPC) with docetaxel often fails due to the emergence of chemoresistance. Thus, restoring chemosensitivity to docetaxel-based therapies remains a challenge in mCRPC treatment. microRNA (miR)-451 expression was measured in docetaxel-treated prostate cancer cells and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique