Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU088741

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Michael F Emmons et al.
Cancer research, 79(11), 2947-2961 (2019-04-17)
Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype in response to multiple stimuli. Here, we show that exposure of melanomas to multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV irradiation leads to an increase in
G R Vanaja et al.
Cell communication and signaling : CCS, 16(1), 20-20 (2018-05-03)
Histone deacetylases (HDACs) are involved in epigenetic gene regulation via deacetylation of acetylated lysine residues of both histone and non-histone proteins. Among the 18 HDACs identified in humans, HDAC8, a class I HDAC, is best understood structurally and enzymatically. However
Zhouxiang Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1645-1653 (2016-11-17)
Despite the use of novel anti-myeloma agents,nearly all patients will eventually relapse or become refractory to drug treatment. New and more effective drugs for multiple myeloma (MM) are urgently needed. The JAK-STAT signaling pathway is important in the proliferation of
Ganggang Kong et al.
Journal of neurotrauma, 34(18), 2645-2655 (2017-07-08)
The ketone metabolite β-hydroxybutyrate (βOHB), is reported to be neuroprotective after spinal cord injury (SCI) in rats, but the underlying mechanism remains unknown. The present study aims to investigate effects of βOHB on suppression of oxidative stress and inhibition of
Jia Li et al.
American journal of physiology. Cell physiology, 307(3), C288-C295 (2014-06-13)
Histone deacetylases (HDACs) are a family of enzymes that mediate nucleosomal histone deacetylation and gene expression. Some members of the HDAC family have also been implicated in nonhistone protein deacetylation, which modulates cell-cycle control, differentiation, and cell migration. However, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique