Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084491

Sigma-Aldrich

MISSION® esiRNA

targeting human CHAF1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTGAATCTTGTCCCAAAGGGGAAAGCCGATGACATGTCAGACGATCAGGGTACTTCTGTGCAAAGTAAAAGCCCCGATTTAGAGGCCTCTTTGGACACCTTGGAAAACAACTGTCATGTGGGTTCTGACATAGACTTTAGACCGAAACTTGTCAACGGGAAGGGTCCCTTAGATAACTTTTTAAGAAATAGAATCGAAACCAGTATTGGCCAGAGCACAGTCATCATTGATTTGACAGAGGACTCGAATGAGCAGCCAGACAGTCTTGTGGACCACAATAAACTAAATTCTGAAGCCTCTCCCTCCAGGGAGGCAATAAATGGCCAGCGAGAAGACACTGGGGATCAGCAGGGGTTGTTGAAGGCCATTCAGAACGACAAGTTGGCATTTCCTGGAGAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

CHAF1A (chromatin assembly factor 1 subunit A) is one of the subunits of CAF1 complex, a histone chaperone responsible for the positioning of histone H3 and H4 dimers into nucleosomes. CAF1 is needed for S-phase progression, heterochromatin formation and chromatin restoration after DNA repair. CAF1A is required for promoting protein and chromosome associations with nucleoli. It is required for cell proliferation and is upregulated in colon cancer and aggressive neuroblastoma.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli.
Smith CL, et. al.
Molecular Biology of the Cell, 25, 2866-2866 (2014)
The Chromatin Assembly Factor Complex 1 (CAF1) and 5-Azacytidine (5-AzaC) Affect Cell Motility in Src-transformed Human Epithelial Cells.
Endo A
The Journal of Biological Chemistry, 292, 172-172 (2017)
Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A.
Yang C
Nucleic Acids Research, 45, 739-739 (2017)
Corey L Smith et al.
Molecular biology of the cell, 25(18), 2866-2881 (2014-07-25)
Chromatin assembly factor-1 (CAF-1) is a three-subunit protein complex conserved throughout eukaryotes that deposits histones during DNA synthesis. Here we present a novel role for the human p150 subunit in regulating nucleolar macromolecular interactions. Acute depletion of p150 causes redistribution

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique