Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU081851

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPT2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG

Numéro d'accès Ensembl | humain

ENSG00000091879

Numéro d'accès NCBI

NM_001147

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ANGPT2(285) , ANGPT2(285)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Jing Xu et al.
American journal of physiology. Cell physiology, 313(3), C262-C273 (2017-06-24)
Angiopoietin-2 (Ang-2) contributes to vascular hyporeactivity after hemorrhagic shock and hypoxia through upregulation of inducible nitric oxide synthase (iNOS) in a vascular endothelial cell (VEC)-specific and Ang-2/Tie2 receptor-dependent manner. While iNOS is primarily expressed in vascular smooth muscle cells (VSMCs)
Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique