Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Numéro d'accès Ensembl | humain

ENSG00000087470

Numéro d'accès NCBI

NM_005690

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DNM1L(10059) , DNM1L(10059)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
S Xu et al.
Cell death & disease, 4, e540-e540 (2013-03-16)
Mitochondria are critical targets in the hepatotoxicity of cadmium (Cd). Abnormal mitochondrial dynamics have been increasingly implicated in mitochondrial dysfunction in pathophysiological conditions. Therefore, our study aimed to investigate the effects and underlying mechanism of Cd on mitochondrial dynamics during
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique