Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081371

Sigma-Aldrich

MISSION® esiRNA

targeting human FUBP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGAAAAGGGGGAGAAACTATTAAACAGCTTCAGGAACGGGCTGGAGTTAAAATGGTTATGATTCAAGACGGGCCGCAGAACACTGGTGCTGACAAACCTCTTAGGATTACAGGAGACCCATATAAAGTTCAACAAGCCAAGGAAATGGTGTTAGAGTTAATTCGTGATCAAGGCGGTTTCAGAGAAGTTCGGAATGAGTATGGGTCAAGAATAGGAGGAAATGAAGGGATAGATGTCCCCATTCCAAGATTTGCTGTTGGCATTGTAATAGGAAGAAATGGAGAGATGATCAAAAAAATACAAAATGATGCTGGTGTTCGCATTCAGTTTAAGCCAGATGATGGGACAACACCCGAAAGGATAGCACAAATAACAGGACCTCCAGACCGATGTCAACATGCT

Numéro d'accès Ensembl | humain

ENSG00000162613

Numéro d'accès NCBI

NM_003902

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FUBP1(8880) , FUBP1(8880)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yang Chen et al.
The International journal of biological markers, 35(2), 56-65 (2020-04-28)
A well-known transcriptional regulator of the proto-oncogene c-Myc, far-upstream element (FUSE) binding protein 1 (FUBP1) has been demonstrated by previous work to be aberrantly expressed in lots of cancers and plays a critical role in tumor progression; however, its expression
Michael Seiler et al.
Cell reports, 23(1), 282-296 (2018-04-05)
Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA), and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique