Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081001

Sigma-Aldrich

MISSION® esiRNA

targeting human FZR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACACGCTGACAGGACAACCACTGCAGTGTATCGACACGGGCTCCCAAGTGTGCAATCTGGCCTGGTCCAAGCACGCCAACGAGCTGGTGAGCACGCACGGCTACTCACAGAACCAGATCCTTGTCTGGAAGTACCCCTCCCTGACCCAGGTGGCCAAGCTGACCGGGCACTCCTACCGCGTGCTGTACCTGGCAATGTCCCCTGATGGGGAGGCCATCGTCACTGGTGCTGGAGACGAGACCCTGAGGTTCTGGAACGTCTTTAGCAAAACCCGTTCGACAAAGGAGTCTGTGTCTGTGCTCAACCTCTTCACCAGGATCCGGTAAACCTGCCGGGCAGGACCGTGCCACACCAGCTGTCCAGAGTCGGAGGACCCCAGCTCCTCAGCTTGCATGGACTCTG

Numéro d'accès Ensembl | humain

ENSG00000105325

Numéro d'accès NCBI

NM_016263

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FZR1(51343) , FZR1(51343)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique