Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU078041

Sigma-Aldrich

MISSION® esiRNA

targeting human PMAIP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGACTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAATTTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGAATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCGAAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTGTTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhenqian Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1574-1579 (2017-09-28)
Colorectal cancer (CRC) cells undergo apoptosis in the presence of the small-molecule inhibitor ABT-263 by up-regulating antiapoptotic Bcl-2 family members. However, the resistance to ABT-263 gradually developed in most solid tumors due to its low affinity to Mcl-1. Here, we
Patricia Gomez-Bougie et al.
Cancer letters, 383(2), 204-211 (2016-10-25)
As myeloma cells actively produce and secrete immunoglobulins, they are prone to ER stress, which if unresolved leads to apoptosis. We found that myeloma cell death induced by the ER stressor Thapsigargin was highly variable, ranging from 2 to 89%.
Liz J Hernandez-Borrero et al.
Cell cycle (Georgetown, Tex.), 17(5), 557-567 (2017-07-28)
P53 tumor suppressor gene mutations occur in the majority of human cancers and contribute to tumor development, progression and therapy resistance. Direct functional restoration of p53 as a transcription factor has been difficult to achieve in the clinic. We performed
Eugene Y Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201800425R-fj201800425R (2018-05-26)
Rheumatoid arthritis (RA) is characterized by hyperplastic pannus formation mediated by activated synovial fibroblasts (RASFs) that cause joint destruction. We have shown earlier that RASFs exhibit resistance to apoptosis, primarily as a result of enhanced expression of myeloid cell leukemia-1
Yohei Sugimoto et al.
Molecular cancer therapeutics, 19(10), 1992-2000 (2020-08-28)
Rhabdoid tumor is an aggressive, early childhood tumor. Biallelic inactivation of the SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 (SMARCB1)/integrase interactor 1 (INI1) gene is the only common genetic feature in rhabdoid tumors. Loss of SMARCB1 function

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique