Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU071571

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGCTCCTCTGACAAGACCATCAAGGTGTGGGACACATGTACCACCTACAAGTGTCAGAAGACACTGGAGGGCCATGATGGCATCGTGCTGGCTCTCTGCATCCAGGGGTGCAAACTCTACAGCGGCTCTGCAGACTGCACCATCATTGTGTGGGACATCCAGAACCTGCAGAAGGTGAACACCATCCGGGCCCATGACAACCCGGTGTGCACGCTGGTCTCCTCACACAACGTGCTCTTCAGCGGCTCCCTGAAGGCCATCAAGGTCTGGGACATCGTGGGCACTGAGCTGAAGTTGAAGAAGGAGCTCACAGGCCTCAACCACTGGGTGCGGGCCCTGGTGGCTGCCCAGAGCTACCTGTACAGCGGCTCCTACCAGACAATCAAGATCTGGGACATCCGAACCCTTGACTGCATCCACGTCCTGCAGACGTCTGGTGGCAGCGTCTACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dawei Xu et al.
Neuropeptides, 71, 81-89 (2018-08-14)
TNF receptor-associated factor 7 (TRAF7), is an E3 ubiquitin ligase for several proteins involved in the activation of TLR-dependent NF-kappaB signaling. TRAF7 links TNF receptor family proteins to signaling pathways, thus participates in regulating cell death and survival mediated by
Keisuke Shirakura et al.
Journal of cell science, 132(1) (2018-12-05)
Roundabout guidance receptor 4 (Robo4) is an endothelial cell-specific receptor that stabilizes the vasculature in pathological angiogenesis. Although Robo4 has been shown to suppress vascular hyperpermeability induced by vascular endothelial growth factor (VEGF) in angiogenesis, the role of Robo4 in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique