Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU071471

Sigma-Aldrich

MISSION® esiRNA

targeting human AL513122.2, GSN, AL513122.1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCACCAACCTTTATGGAGACTTCTTCACGGGCGACGCCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGACCTCCACTACTGGCTGGGCAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTTACCGTGCAGCTGGATGACTACCTGAACGGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGCTTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTGGCCTGAAGTACAAGAAAGGAGGTGTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCAGAGACTCTTCCAGGTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTCAACAATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAACAG

Numéro d'accès Ensembl | humain

ENSG00000148180

Numéro d'accès NCBI

NM_198252

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AL513122.2(2934) , GSN(2934)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhi-Yuan Chen et al.
Journal of biomedical science, 22, 90-90 (2015-10-21)
Increasing evidence suggests that transforming growth factor-beta 1 (TGF-β1) triggers epithelial to mesenchymal transition (EMT) and facilitates breast cancer stem cell differentiation. Gelsolin (GSN) is a ubiquitous actin filament-severing protein. However, the relationship between the expression level of GSN and
Meshach Asare-Werehene et al.
Oncogene, 39(7), 1600-1616 (2019-11-09)
Ovarian cancer (OVCA) is the most lethal gynecological cancer, due predominantly to late presentation, high recurrence rate and common chemoresistance development. The expression of the actin-associated protein cytosolic gelsolin (GSN) regulates the gynecological cancer cell fate resulting in dysregulation in
Dylan Z Kelley et al.
Translational research : the journal of laboratory and clinical medicine, 202, 109-119 (2018-08-18)
We have recently performed the characterization of alternative splicing events (ASEs) in head and neck squamous cell carcinoma, which allows dysregulation of protein expression common for cancer cells. Such analysis demonstrated a high ASE prevalence among tumor samples, including tumor-specific

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique