Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU070891

Sigma-Aldrich

MISSION® esiRNA

targeting human PKP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCAGAGCTCCTTCCACAGCACCCGCACGCTGAGGGAAGCTGGGCCCAGTGTCGCCGTGGATTCCAGCGGGAGGAGAGCGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGAAGTGGGAATCTGCTCACTGAGAGAAGCACTTTCACTGACTCCCAGCTGGGGAATGCAGACATGGAGATGACTCTGGAGCGAGCAGTGAGTATGCTCGAGGCAGACCACATGCTGCCATCCAGGATTTCTGCTGCAGCTACTTTCATACAGCACGAGTGCTTCCAGAAATCTGAAGCTCGGAAGAGGGTTAACCAGCTTCGTGGCATCCTCAAGCTTCTGCAGCTCCTAAAAGTTCAGAATGAAGACGTTCAGCGAGCTGTGTGTGGGGCCTTGAGAAACTTAGTATTTGAAGACAATGACAACAAATTGGAGGTGGCTGAACTAAATGGGGTACCTCGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Degeng Zhang et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 37(3), 207-216 (2017-01-27)
Glioma is the most common type of primary brain tumor in the CNS. Due to its poor prognosis and high mortality rates, it is urgent to find out more effective therapies. Plakophilin-2 (PKP2) is a widespread desmosomal plaque protein. Recently
Oxana E Nekrasova et al.
The Journal of cell biology, 195(7), 1185-1203 (2011-12-21)
The desmosomal cadherins, desmogleins (Dsgs) and desmocollins (Dscs), comprise the adhesive core of intercellular junctions known as desmosomes. Although these adhesion molecules are known to be critical for tissue integrity, mechanisms that coordinate their trafficking into intercellular junctions to regulate

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique