Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU069011

Sigma-Aldrich

MISSION® esiRNA

targeting human CS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CS(1431) , CS(1431)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pei-Yao Xu et al.
International journal of nanomedicine, 13, 4685-4698 (2018-08-30)
In recent times, the co-delivery therapeutics have garnered enormous interest from researchers in the treatment of cancers with multidrug resistance (MDR) due to their efficient delivery of multiple agents, which result in synergistic effects and capable of overcoming all the
Takeshi Nakajima et al.
Investigative ophthalmology & visual science, 55(8), 5278-5283 (2014-07-24)
Activation of calpains (calpain 2 and Lp82) in rodent lenses readily causes proteolysis and cataract formation. In contrast, primate lenses are quite resistant to activation of calpains. The hypothesis is that high levels of human endogenous calpain inhibitor, calpastatin (CS)
Ana Vanessa Nascimento et al.
Molecular pharmaceutics, 11(10), 3515-3527 (2014-09-27)
RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique