Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Numéro d'accès Ensembl | humain

ENSG00000117713

Numéro d'accès NCBI

NM_006015

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ARID1A(8289) , ARID1A(8289)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Saravana P Selvanathan et al.
Nucleic acids research, 47(18), 9619-9636 (2019-08-09)
Connections between epigenetic reprogramming and transcription or splicing create novel mechanistic networks that can be targeted with tailored therapies. Multiple subunits of the chromatin remodeling BAF complex, including ARID1A, play a role in oncogenesis, either as tumor suppressors or oncogenes.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique