Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU066321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGGAGGTGAAGAACTTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAACATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGGTCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCTAAGACCTACATCGCCAGCCAGGGTTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATGGCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGGAACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCTGTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCCCCGCTGGACAATGGAGACCTGATTCGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jieqiong Wang et al.
Breast cancer research and treatment, 148(2), 279-289 (2014-10-11)
Signal transducer and activator of transcription 3 (STAT3) is implicated breast cancer metastasis and represents a potential target for developing new anti-tumor metastasis drugs. The purpose of this study is to investigate whether the natural agent 1'-acetoxychavicol acetate (ACA), derived
Tiantian Sun et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(17), 4689-4704 (2014-07-06)
The role and clinical implication of the transmembrane protein with EGF and two follistatin motifs 2 (TMEFF2) in gastric cancer is poorly understood. Gene expression profile analyses were performed and Gene Set Enrichment Analysis (GSEA) was used to explore its
Ji Hoon Jung et al.
British journal of pharmacology, 172(14), 3565-3578 (2015-04-01)
Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Derivatives of EGCG were
Ross C Gruber et al.
Glia, 63(10), 1753-1771 (2015-04-29)
We have previously described reduced myelination and corresponding myelin basic protein (MBP) expression in the central nervous system of Src homology 2 domain-containing protein tyrosine phosphatase 1 (SHP-1) deficient motheaten (me/me) mice compared with normal littermate controls. Deficiency in myelin
Chulwon Kim et al.
Molecular carcinogenesis, 53(10), 793-806 (2013-06-15)
Constitutive activation of STAT3 is frequently observed and closely linked with proliferation, survival, invasion, metastasis and angiogenesis in tumor cells. In the present study, we investigated whether β-caryophyllene oxide (CPO), a sesquiterpene isolated primarily from the essential oils of medicinal

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique