Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU065431

Sigma-Aldrich

MISSION® esiRNA

targeting human KEAP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min-Kyun Song et al.
Free radical biology & medicine, 138, 33-42 (2019-05-07)
Transforming growth factor-β (TGF-β) is a potent pathogenic factor of renal injury through the upregulation of extracellular matrix (ECM) expression and facilitation of renal fibrosis. Nuclear factor erythroid 2-like 2 (Nfe2l2; Nrf2), a master regulator of antioxidant and detoxifying systems
Jinqian Liang et al.
Cell death & disease, 10(12), 888-888 (2019-11-27)
Activation of nuclear-factor-E2-related factor 2 (Nrf2) cascade can alleviate dexamethasone (DEX)-induced oxidative injury and death of human osteoblasts. A recent study has shown that phosphoglycerate kinase 1 (PGK1) inhibition/depletion will lead to Kelch-like ECH-associated protein 1 (Keap1) methylglyoxal modification, thereby
Min Cai et al.
Anesthesiology, 126(3), 507-521 (2017-01-04)
The authors have reported that antioxidative effects play a crucial role in the volatile anesthetic-induced neuroprotection. Accumulated evidence shows that endogenous antioxidation could be up-regulated by nuclear factor-E2-related factor 2 through multiple pathways. However, whether nuclear factor-E2-related factor 2 activation
Indira D Pokkunuri et al.
American journal of physiology. Renal physiology, 319(4), F686-F696 (2020-08-25)
Renal proximal tubular apoptosis plays a critical role in kidney health and disease. However, cellular molecules that trigger renal apoptosis remain elusive. Here, we evaluated the effect of inhibiting protein disulfide isomerase (PDI), a critical thioredoxin chaperone protein, on apoptosis
Weixia Sun et al.
Free radical biology & medicine, 108, 840-857 (2017-05-02)
Epigallocatechin gallate (EGCG) is the most abundant and effective green tea catechin and has been reported to attenuate diabetic nephropathy (DN). However, the mechanism by which EGCG ameliorates DN, till now, has remained unclear. EGCG is known as a potent

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique